An engineered UGA suppressor tRNA gene for disease-agnostic AAV delivery

https://www.profitableratecpm.com/f4ffsdxe?key=39b1ebce72f3758345b2155c98e6709c

Cell culture and transfection

HEK293 cells were maintained in DMEM (Gibco, 11965-084) supplemented with 10% (v/v) FBS (Gibco, 26140-079) and 1% (v/v) penicillin–streptomycin antibiotics (Thermo Fisher Scientific, 15140122) at 37 °C with 5% CO2. Patient-derived fibroblasts were purchased from the Coriell Institute and were maintained in Eagle’s minimum essential medium (American Type Culture Collection (ATCC), 30-2003) supplemented with 15% (v/v) FBS (Gibco, 26140-079) and 1% (v/v) penicillin–streptomycin antibiotics (Thermo Fisher Scientific, 15140122) at 37 °C with 5% CO2. Transfection of the fibroblasts derived from an IDUA−/− participant (Coriell Institute, GM00798) was performed using TransfeX (ATCC, ACS-4005). CLN2 patient-derived fibroblasts (Coriell Institutes, GM16485) were infected with lentiviral vectors at a multiplicity of infection of 300 in the presence of 8 µg ml−1 polybrene (Sigma-Aldrich, TR-1003-G). G418 (Life Technologies, 10131-027) was added to culture medium to a final concentration of 0.5 mg ml−1 at 24 h before cell collection. Fibroblasts derived from an IDUA+/− individual (Coriell Institute, GM00799) were used as normal control.

Dual-luciferase reporter assay to measure PTC readthrough in HEK293 cells

The dual-luciferase reporter expresses the Cypridina luciferase (CLuc) and GLuc, which are separated by the T2A sequence and the Mecp2R168X sequence context. HEK293 cells were cotransfected with 150 ng per well of reporter plasmid and 1.2 ng per well of sup-tRNA plasmid in a 24-well plate using polyethylenimine (Polysciences, 23966-1). Cell culture medium was collected 24 h after transfection. CLuc was measured with a Pierce CLuc glow assay kit (Thermo Scientific, 16171) and GLuc was measured with a Pierce GLuc flash assay kit (Thermo Scientific, 16159) using a plate reader (BioTek) according to the manufacturer’s instructions. The readthrough efficiency was defined as the GLuc/CLuc ratio from the Mecp2R168X construct normalized to the ratio observed for the WT construct (Mecp2).

Digenic reporter assay to measure PTC readthrough in HEK293 cells

The digenic reporter expresses GLuc-R44X and EGFP-Y39X under a bidirectional promoter58,59. The reporter plasmid with WT GLuc and EGFP serves as WT control. HEK293 cells were cotransfected with 500 ng per well of the reporter plasmid, 500 ng per well of the CymR plasmid or an mCherry plasmid as control and 5 ng per well of the sup-tRNA plasmid using Lipofectamine 3000 (Invitrogen, L3000015) in a 12-well plate. GLuc in cell culture medium was measured 48 h after transfection and normalized to GLuc expressed from the WT reporter to calculate the readthrough efficiency. EGFP fluorescence in HEK293 cells was imaged using a Leica inverted fluorescence microscope. EGFP fluorescence intensity was quantified by ImageJ.

Animal use and treatment

The IduaKI/KI mouse model on the C57BL/6J background was generated using CRISPR-mediated gene editing. Cln2R207X mice were purchased from the Jackson Laboratory (JAX, 030696) and bred in-house. To study sup-tRNA levels, charging efficiency and treatment safety, heterozygous Cln2R207 mice were used and killed at 10 weeks after treatment. For hydrodynamic injection, WT mice were intravenously injected with 2.5 ml of saline containing 25 µg of reporter plasmid and 25 µg of sup-tRNA plasmid. The mice were killed at 24 h after injection. rAAV vectors were intravenously administered at the dose of 3.5 × 1012 vector genomes per mouse and killed at 4 or 20 weeks after treatment as indicated to assess therapeutic efficacy in homozygous IduaKI/KI and Cln2R207/R207X mice. Mice were perfused with ice-cold PBS and tissues were immediately dissected, snap-frozen in liquid nitrogen and stored at −80 °C. All mice were housed at 22 ± 2 °C with 40% humidity and a 12 h light–dark cycle. All animal procedures were reviewed and approved by The Institutional Animal Care and Use Committee at the University of Massachusetts Chan Medical School (PROTO202100011 and PROTO202100013) and performed in compliance with all relevant ethical regulations.

Western blotting

Cell cultures were lysed in ice-cold M-PER mammalian protein extraction reagent (Thermo Fisher Scientific, 78501) with protease inhibitor (Roche, 4693159001). Tissues were homogenized in ice-cold T-PER protein extraction reagent (Thermo Fisher Scientific, 78510) with protease inhibitor (Roche, 4693159001) using TissueLyser II (Qiagen). Total protein concentration was measured using the bicinchoninic acid (BCA) assay (Pierce, 23225). Normalized protein lysate was boiled with 4× Laemmli sample buffer (Bio-Rad, 1610747) at 95 °C for 5 min. The primary antibodies mouse anti-Flag M2 (Sigma, F1804; 1:5,000 dilution), rabbit anti-mCherry (Novus biologicals, NBP2-25157; 1:3,000 dilution), rabbit anti-GAPDH (Abcam, ab9485; 1:5,000 dilution), mouse anti-AAV VP1/VP2/VP3 (PROGEN, 690058; 1:500 dilution) and mouse anti-AAV2 Rep (PROGEN, 61069; 1:200 dilution) and the secondary antibodies LI-COR IRDye 680RD goat anti-rat IgG (H + L) (LI-COR Biosciences, 926-68076; 1:10,000 dilution), LI-COR IRDye 680RD goat anti-mouse IgG (H + L) (LI-COR Biosciences, 926-68070; 1:10,000 dilution), LI-COR IRDye 800CW goat anti-rabbit IgG (H + L) (LI-COR Biosciences, 926-32211; 1:10,000 dilution) and LI-COR IRDye 800CW goat anti-mouse IgG (H + L) (LI-COR Biosciences, 926-32210; 1:10,000 dilution) were used in western blotting. Blot membranes were scanned with a LI-COR scanner (Odyssey). Western blot quantification analysis was performed with Image Studio Lite (LI-COR).

Plasmids

All sup-tRNA and reporter constructs were cloned into rAAV single-stranded transfer plasmid using NEBuilder HiFi DNA assembly master mix (New England BioLabs, E2621) and verified by whole-plasmid sequencing. The sequences of sup-tRNA and reporter expression cassettes are provided in Supplementary Table 4.

AAV vector production using adherent HEK293 cells

A small-scale AAV vector production assay was performed by standard triple transfection of HEK293 cells in 24-well plates. Each well was transfected with 0.25 µg each of three plasmids carrying the vector genome (pCis), Rep/Cap (pTrans, pRep2/Cap9; Addgene, 112865) and adenovirus helper genes (pHelper; Addgene, 112867) using the calcium phosphate method (Promega, E1200). In low-cis triple transfection, the pCis plasmid was reduced to 10% or 1% by mass. In the quadruple transfection with the additional CymR plasmid (pCymR), 0.2 µg of pCymR was cotransfected. The culture medium was replaced with DMEM supplemented with 1% penicillin–streptomycin without FBS at 24 h after transfection. Cells and culture media were harvested at 72 h after transfection and subjected to three consecutive freeze–thaw cycles. The crude lysates were centrifuged at 14,000g per min for 10 min at 4 °C to remove cell debris. Cleared crude lysates were treated with DNase-I for 1 h at 37 °C and proteinase K followed by tittering by droplet digital (ddPCR).

Midiscale AAV vectors packaging various genome designs (VG1–VG4) were produced in three 15-cm dishes for each vector. Then, 15 µg each of pCis, pRep/Cap and pHelper plasmids were cotransfected to cells cultured in one 15-cm dish using polyethylenimine. After 24 h, cell culture medium was replaced with DMEM supplemented with 1% penicillin–streptomycin without FBS. Then, 72 h after transfection, cells and culture media were harvested. rAAV vectors were purified with AAVpro Purification Kit (Takara, 6675) following the manufacturer’s instructions.

In large-scale AAV vector production, the calcium phosphate method was used to cotransfect 1.5 mg each of pCis, pRep/Cap and pHelper plasmids to approximately 1 × 109 cells cultured in ten roller bottles. When the additional pCymR was used, 1.2 mg of pCymR was cotransfected. Then, 72 h after transfection, AAV vectors were purified through two rounds of cesium chloride density gradient centrifugation. Titers of purified AAV vectors were quantified by ddPCR.

AAV vector DNA analysis by alkaline agarose gel electrophoresis and nanopore sequencing

AAV vector DNA was extracted from purified rAAV using QIAamp DNA blood mini kit (Qiagen, 51104) following the manufacturer’s protocol for viral DNA isolation. Briefly, 0.8% agarose (w/v) gel was made with ultrapure water and 0.1 volumes of 10× alkaline agarose gel electrophoresis buffer (500 mM NaOH and 10 mM EDTA) was added when cooled to 55 °C. Purified vector DNA was mixed with 6× alkaline gel loading buffer (Thermo Fisher Scientific, AAJ62157AB) and 10× alkaline agarose buffer and loaded to alkaline gel. Electrophoresis was performed at a voltage of 3 V cm−1 on ice for approximately 3 h. Then, the gel was soaked in neutralization solution (BioWorld, 10750014) for 45 min at room temperature. The neutralized gel was stained with SYBR gold (1:10,000 dilution, Thermo Fisher Scientific, S11494) in 1× TAE buffer for 15 min and imaged using a Bio-Rad Gel Doc XR+ Imaging System. Nanopore sequencing of the AAV vector DNA was conducted by Plasmidsaurus and analyzed using Geneious Prime.

Generation of CymR stable cell lines

Adherent HEK293 cells were transfected with a mixture of a Cas9-expressing plasmid, an AAVS1-targeting sgRNA plasmid (courtesy of A. Brown; target sequence: CTGTCCCTAGTGGCCCCACTG) and the donor plasmid pAAVS1 LHA-SA-P2A-CymR-T2A-PuroR-bGH (pHL379) at a mass ratio of 1:1:3. Transfection was performed using Lipofectamine 2000 (Thermo Scientific, 11668027). Then, 3 days after transfection, the cells were split and selected with puromycin (1 µg ml−1) for 7 days. Monoclonal cell lines were isolated through serial dilution, expanded and subjected to a CymR function assay to identify candidate clones.

IDUA enzyme activity assay

Patient-derived fibroblasts were lysed in ice-cold M-PER protein extraction reagent (Thermo Fisher Scientific, 78501) with protease inhibitor (Roche, 11873580001). Tissues were homogenized in ice-cold T-PER protein extraction reagent (Thermo Fisher Scientific, 78510) with protease inhibitor (Roche, 4693159001) using TissueLyser II (Qiagen). The lysates were centrifuged at 14,000g per min for 15 min at 4 °C and the supernatant was collected for total protein quantification using the BCA assay (Pierce, 23225). Fibroblast lysates containing around 6 µg of total protein or tissue lysates containing 60 µg of total protein were used in the enzymatic reaction (100 µl of total reaction volume), which included sodium formate buffer pH 3.5 (130 mM), d-saccharic acid 1,4-lactone monohydrate (0.42 mg ml−1; Sigma-Aldrich, S0375) and 4MU-iduronic acid (0.12 mM; Santa Cruz Biotechnology, sc-220961). The reaction was incubated at 37 °C for 20 h and quenched with glycine buffer, pH 10.8. The fluorescence of released 4MU (excitation wavelength: 365 nm; emission wavelength: 450 nm) was detected using a plate reader (BioTek) and compared against a standard curve generated using 4MU (Sigma-Aldrich, M1381). The relative IDUA activity was normalized to the IDUA activity detected with WT samples.

TPP1 enzyme activity assay

Total protein of cell or tissue lysates were determined using the BCA assay (Pierce, 23225) and normalized to the same total protein concentration. Then, 10 µl of each lysate was incubated with 20 µl of activation buffer (150 mM NaCl, 0.1% Triton X-100 and 50 mM formic acid/sodium formate, pH 3.5) at 37 °C for 30 min. After activation, 20 µl of reaction solution containing 500 µM of Ala-Ala-Phe 7-amido-4-methylcoumarin substrate (Sigma, A34010) in substrate buffer (150 mM NaCl, 0.1% Triton X-100 and 100 mM sodium acetate, pH 4.0) was added. Fluorescence from the released 4MU was continuously monitored at 37 °C every 10 min for 2 h using a plate reader (BioTek) set to kinetic mode (excitation: 365 nm; emission: 450 nm). TPP1 activity was measured within the linear range and compared against a standard curve generated using 7-amino-4-methylcoumarin (Sigma, A9891).

ddPCR

RNA and DNA were extracted from mouse liver or heart using an AllPrep DNA/RNA Mini kit (Qiagen, 80204). Muscle RNA and DNA were isolated with TRIzol (Invitrogen, 15596018) and QIAamp DNA mini kit (Qiagen, 51304), respectively. Isolated RNA was reverse transcribed using a high-capacity complementary DNA (cDNA) reverse transcription kit (Fisher Scientific, 43-688-13). Mouse Idua or Tpp1 cDNA was quantified in a multiplexed ddPCR reaction using Taqman reagents targeting Idua (Thermo Fisher Scientific, assay ID: Mm01198845_m1) or Tpp1 (Thermo Fisher Scientific, assay ID: Mm00487016_m1), respectively, and mTbp (Thermo Fisher Scientific, assay ID: Mm01277042_m1). The titers of AAV vectors were quantified using a customized Taqman reagent targeting mCherry (forward primer: CAGAGGCTGAAGCTGAAGGA; reverse primer: GCTTCTTGGCCTTGTAGGTG; probe: CGGCGGCCACTACGACGCTG). CymR sequence was quantified using a customized Taqman reagent (forward primer: CTGGCAACATTTGAGTGGCT; reverse primer: AAGAATTCGGCTGCATCGTC; probe: AGCGAGCCGGGCTCTGCTCC). AAV vector genome copy number in mouse tissues was quantified using Taqman reagent targeting mCherry and Tfrc (Thermo Fisher Scientific, 4458367). ddPCR was performed with a QX200 instrument (Bio-Rad) following manufacturer’s instructions.

Lentiviral vectors

hNFS-CuO-R8 and EGFP driven by the CMV promoter were cloned into the lentiviral transfer plasmid pLenti-CSCGW2. Lentiviral vectors were packaged using the third-generation system. The transfer plasmid was cotransfected with packaging plasmids (pMDLg/Prre and pRSV/REV) and the envelope plasmid (pHCMV/VSVG) into HEK293T cells using the calcium phosphate method. Medium was collected at 48 h and 72 h after transfection and ultracentrifuged to concentrate virus. The virus titer was determined using a QuickTiter lentivirus titer kit (Cell Biolabs, VPK-107).

Sup-tRNA quantification and measurement of tRNA charging efficiency

Total RNA from tissues was extracted using TRIzol (Invitrogen, 15596018) and resuspended in acetate buffer (10 mM sodium acetate pH 4.5 and 1 mM EDTA pH 8.0). RNA was subjected to periodate oxidation in freshly prepared 50 mM NaIO4 and β-elimination in 60 mM sodium borate as previously described60. Mature tRNAs were isolated by denaturing 8% TBE–urea PAGE and recovered by crush-and-soak method. For sup-tRNA quantification in HEK293 cells, total RNA was extracted using TRIzol (Invitrogen, 15596018) and dissolved in RNase-free water, followed by deacylation in 75 mM Tri-HCl (pH 9.0) as previously described61. Small RNA (17–200 nt) including mature tRNA was isolated using Zymo RNA clean and concentrator kit (R1017). tRNAs were demethylated with the rtStar tRF&tiRNA pretreatment kit (Arraystar, AS-FS-005) according to the manufacturer’s instructions, followed by end repair using T4 PNK (New England Biolabs, M0201S) and ligated with 3′ adaptor (5′-pGATTCTAGCAAGATCGGAAGAGCACACGTCTGAA/ddC/-3′) using T4 RNA ligase 2, truncated KQ (New England Biolabs, M0373L). tRNA was cleaned up using Zymo RNA clean and concentrator kit (Zymo Research, R1015) before being processed to the next reaction. Adaptor-ligated tRNAs were isolated by denaturing 8% TBE–urea PAGE and recovered by crush-and-soak method. Adaptor-ligated tRNAs were incubated with SuperScript IV reverse transcriptase (Invitrogen, 18090200) at 55 °C for 18 h with the primer JW845 (5′-TTCAGACGTGTGCTCTTCCGATCTTGCTAGAATC-3′). KAPA HiFi HotStart ReadyMix (Roche, 7958935001) was used to amplify tRNA cDNA using primers MX250 (5′-CTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGGCCCCAGTGGCCTAATGGATAAG-3′) and JM857 (5′-CCTTGAAGTCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTGTCGCCCTTCAGACGTGTGCTCTTCCGATCTTGCTAGAATC-3′). Amplicons were purified with Zymo gel DNA recovery kit (Zymo Research, D4001) and subjected to nanopore sequencing at Plasmidsaurus. Sequencing reads were analyzed using Geneious Prime.

Immunoprecipitation and MS

The plasmids expressing 2×hNFS-R8 and mIdua cDNA (WT or W401X) fused with a FLAG tag on the C terminus were cotransfected in HEK293 cells. Cells were collected 48 h after transfection and lysed in lysis buffer (50 mM Tris-HCl, 150 mM NaCl and 1% Triton X-100, pH 7.4) with protease inhibitor (Roche, 4693159001). mIDUA–FLAG protein was incubated with anti-FLAG M2 affinity gel beads (Sigma-Aldrich, A2220-5ML) at 4 °C overnight, eluted with 4× Laemmli sample buffer (Bio-Rad, 1610747) at 95 °C for 10 min and subjected to SDS–PAGE. Gels were stained with Simplyblue SafeStain (Invitrogen, LC6060) to visualize the mIDUA–FLAG bands, which were excised and processed for MS.

MS and analyses were conducted at The MS Facility at UMass Chan Medical School. The gel samples were digested overnight at 37 °C using trypsin (Promega), eluted with 100 µl of 50% acetonitrile in water and then dried in a SpeedVac. The peptides were reconstituted in 20 µl of 0.1% formic acid in 5% acetonitrile, followed by centrifugation at 16,000 rcf for 16 min. Subsequently, 18 µl of the sample was transferred to nonbinding high-performance liquid chromatography (LC) vials. Next, 4 µl of the reconstituted samples was then injected into the MS instrument, a TimsTOF Pro2 (Bruker), coupled with a nanoElute LC system (Bruker). The analysis was carried out on an in-house packed C18 column (250 mm × 75 µm inner diameter, 3 µm, 120-Å pore size) using a 30-min gradient at a flow rate of 500 nl min−1 with a solvent composition of solvent A (0.1% formic acid in water) and solvent B (0.1% formic acid in acetonitrile). The data acquisition was processed in data-dependent analysis using the parallel accumulation–serial fragmentation (PASEF) method. The method consists of 10 MS/MS PASEF scans per topN acquisition cycle, with ramp and accumulation times of 100 ms, covering an m/z range from 100 to 1,700 and an ion mobility range (1/K0) from 0.70 to 1.30 V s cm−2. Collision energy settings followed a linear function of ion mobility, ranging from 20 eV at 0.6 V s cm−2 to 59 eV at 1.6 V s cm−2, using default parameters. Calibration of the instrument was performed using three ions from the ESI-L Tuning Mix (Agilent) (m/z 622, 922 and 1,222).

The raw data were processed using the Fragpipe/MSFragger specific (trypsin) workflow against a database containing all possible amino acid incorporations at position 401. Results were visualized and statistically analyzed using Scaffold version 5.3.3 9 (Proteome Software) and relative quantification of the most probable amino acid incorporation was estimated using Skyline (64-bit) version 24.1.0.414 (5b5ea5889c).

Histology and immunohistochemistry

Mouse tissues were fixed in 10% formalin buffer (Fisher Scientific, SF100-20) overnight and embedded in paraffin. Sectioning, hematoxylin and eosin staining and immunohistochemistry were performed at the Morphology Core at the UMass Chan Medical School under standard conditions. Mouse anti-FLAG M2 (Sigma, F1804; 1:500 dilution) was used in immunohistochemistry. Images were acquired on a Leica DM5500 B microscope.

Clinical serum biochemistry

Mouse blood was collected in a BD SST microtainer (BD Pharmingen, 365967) and centrifuged at 8,000 rpm for 5 min to separate the serum. Serum biochemical analysis was conducted at IDEXX BioAnalytics for the rodent expanded tox panel (60514). The values of normal ranges are from previous studies62,63.

Statistical analysis

Statistical analysis was performed using Prism 10. Comparisons between two groups were analyzed using a two-sided t-test. Comparisons among three or more groups were analyzed using a one-way analysis of variance (ANOVA) followed by a pairwise comparison corrected for multiple comparisons.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Related Articles

Leave a Reply

Your email address will not be published. Required fields are marked *

Back to top button